View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17007_high_6 (Length: 448)
Name: NF17007_high_6
Description: NF17007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17007_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 3e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 294 - 431
Target Start/End: Complemental strand, 9394174 - 9394037
Alignment:
| Q |
294 |
tttaagcccttttccagatttcatttcccatatgaatttggtcgatatttaacaatcttcatcttgcaatgaatcttccaccagttgaagaaagccacag |
393 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9394174 |
tttaagcccttttcccgatttcatttcccatatgaatttggtcgatatttaacaatcttcatcttgcaatgaatcttccaccagttgaagaaagccacag |
9394075 |
T |
 |
| Q |
394 |
tgcaagctaattcagccaatcgaacaccatttacactt |
431 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9394074 |
tgcaagctaattcagtcaatcgaacaccatttacactt |
9394037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 15 - 131
Target Start/End: Complemental strand, 9394842 - 9394728
Alignment:
| Q |
15 |
cagagaagatcatttggctttgttagagaaaataatgtgtatatttcttgactgatagtgaacatttgagctacaaacctatcaatacacaccctgtgat |
114 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9394842 |
cagagaagatcatttcgctttgttagagaaaataatgtgtatatttcttgactgatagtgaatatttgagctacaaacctatcaat--acaccctgtgat |
9394745 |
T |
 |
| Q |
115 |
tcgtcgaccatcatgct |
131 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9394744 |
tcgtcgaccatcatgct |
9394728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University