View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17007_low_21 (Length: 249)
Name: NF17007_low_21
Description: NF17007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17007_low_21 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 15 - 249
Target Start/End: Complemental strand, 33380055 - 33379821
Alignment:
| Q |
15 |
aacctgtgccctaacgtatcaaatgtctctgcaacattttacgatatgagatgtgttcacaagactattttttattaattatacatactaagnnnnnnna |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33380055 |
aacctgtgccctaacgtatcaaatgtctctgcaacattttactatatgagatgtgttcacaagactattttttattaattatacatactaagttttttta |
33379956 |
T |
 |
| Q |
115 |
ttattaattttgtgtggatatagaagagtgtgtgataattggaactaatttatgaaaaattaaatttgcagaggagatagtgctttctgcagtctagagt |
214 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33379955 |
ttattaattttgtgtggatatagaagggtgtgtgataattggaattaatttatgaaaaattaaatttgcagaggagatagtgctttctgcagtctagagt |
33379856 |
T |
 |
| Q |
215 |
gtcgtcaacagcagatgaatcaagatgagaagaaa |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
33379855 |
gtcgtcaacagcagatgaatcaagatgagaagaaa |
33379821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University