View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17007_low_23 (Length: 235)
Name: NF17007_low_23
Description: NF17007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17007_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 52 - 205
Target Start/End: Complemental strand, 42165450 - 42165297
Alignment:
| Q |
52 |
cgatgtgtagtgatgactgatctttttaccatattgaaataattttatacatgcttggctaaaaatatattcatgtatgtatatatgaacaccgaaaaac |
151 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42165450 |
cgatgtgtagtgatgactggtctttttaccatattgaaataattttatacatgcttggctaaaaatatattcatgtatgtatatatgaacactgaaaaac |
42165351 |
T |
 |
| Q |
152 |
attaaaaccttcacgttccttttgtttgtcctagttataggtttttgctttcta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42165350 |
attaaaaccttcacgttccttttgtttgtcctagttataggtttttgctttcta |
42165297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University