View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17007_low_25 (Length: 226)
Name: NF17007_low_25
Description: NF17007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17007_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 18319994 - 18319788
Alignment:
| Q |
1 |
gagtctagaggtccatagatttgaggaaaagacgacaggtatacatagaatcaaacaaattgcgacgcgcgtcaattttgaaaccaaataaataacaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18319994 |
gagtctagaggtccatagatttgaggaaaagacgacaggtatacatagaatcaaacaaattgcgacgcgcgtcaattttgaaaccaaataaataacaata |
18319895 |
T |
 |
| Q |
101 |
acaatatcaactaccattatcaaattgcctcaaattaatctcattcacgaattcacaaacacacagaaaaatatgggcgtggtgataatcgacggcacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18319894 |
acaatatcaactaccattatcaaattgcctcaaattaatctcattcacgaattcacaaacacacagaaaaatatgggcgtggtgataatcgacggcacca |
18319795 |
T |
 |
| Q |
201 |
ccgtgcg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
18319794 |
ccgtgcg |
18319788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University