View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17008_low_2 (Length: 342)
Name: NF17008_low_2
Description: NF17008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17008_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 324
Target Start/End: Original strand, 47421805 - 47422128
Alignment:
| Q |
1 |
tctaattcaaattcaatcaacttccagatccaaattccaccaccgttgatcatcgattctagctggaccaaccacgaacttcttgtactcttcaagatca |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47421805 |
tctaattctaattcaatcaacttccagatccaaattccaccaccgttgatcatcgattctagctggaccaaccacgaacttcttgtactcttcaagatca |
47421904 |
T |
|
| Q |
101 |
catctaccatccacaatttcttcccagatcaactcatcacatgggatcatgtctcaaggtaattacaattattatataaatgtttcattgatatttggtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47421905 |
catctaccatccacaatttcttcccagatcaactcatcacatgggatcatgtctcaaggtaattacaattattatataaatgtttcattgatatttggtt |
47422004 |
T |
|
| Q |
201 |
aattatgtcaatcgttgtgtgcagtaagctagctgagcttgggatcaagaagagtgctcaaaattgtaaggagaagtttgaacatgagaatgcatcattt |
300 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47422005 |
aattatgtcaattgttgtgtgcagtaagctagctgagcttgggatcaagaagagtgctcaaaattgtaaggagaagtttgaacatgagaacgcatcattt |
47422104 |
T |
|
| Q |
301 |
tccccccggttcgttagcgagctt |
324 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
47422105 |
ttcccccggttcgttagcgagctt |
47422128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University