View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1700_high_16 (Length: 321)
Name: NF1700_high_16
Description: NF1700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1700_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 31701960 - 31701899
Alignment:
| Q |
19 |
gtttcacatgatccttgccatatctctatcatatgttcgaatagcctcttcaaaattttcat |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31701960 |
gtttcacatgatccttgccatatctctatcatatgttcgaatagcctcttcaaaattttcat |
31701899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 137
Target Start/End: Complemental strand, 17719974 - 17719868
Alignment:
| Q |
30 |
tccttgccatatctctatcatatgttcgaatagcctcttcaaaattttcatataaacgatttttgaaggagcaaaaactgattaatttgacaataataca |
129 |
Q |
| |
|
|||||||||| |||||| |||||| || ||||||||| |||||||| ||| || |||||||||| | ||||||| ||||||||||||||| |||||| |
|
|
| T |
17719974 |
tccttgccatgtctctaacatatgctccaatagcctcatcaaaattctcacg-aatcgatttttgacagcgcaaaaattgattaatttgacaaaaataca |
17719876 |
T |
|
| Q |
130 |
taaattga |
137 |
Q |
| |
|
|||||||| |
|
|
| T |
17719875 |
taaattga |
17719868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University