View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1700_high_17 (Length: 318)
Name: NF1700_high_17
Description: NF1700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1700_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 19 - 276
Target Start/End: Original strand, 1240899 - 1241156
Alignment:
| Q |
19 |
gaaggaaacataagaaatgagttttccaacacaagatgagtgatcaagagcacaccatttaagacatatccgaaagtttcttagttcatcaaagatcatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1240899 |
gaaggaaacataagaaatgagttttccaacacaagatgagtgatcaagagcacaccatttaagacatatccgaaagtttcttagttcatcaaagatcatg |
1240998 |
T |
 |
| Q |
119 |
gattttgatcttgcataagatggttgaagtaacaaaggaacattgtgttggtgctgttgctgttggtcagagaaagatactcttttggaagatgaattat |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1240999 |
gattttgatcttgcataagatggctgaagtaacaaaggaacattgtgttggtgctgttgctgttggtcagagaaagatactcttttggaagatgaattat |
1241098 |
T |
 |
| Q |
219 |
caatgtcaatggctgtgtccttggttgattctgttgaaggtttcatattgagtttttt |
276 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1241099 |
caatgtcaatggttgtgtccttggttgattctgttgaaggtttcatattgagtttttt |
1241156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University