View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1700_high_24 (Length: 253)
Name: NF1700_high_24
Description: NF1700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1700_high_24 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 88 - 253
Target Start/End: Original strand, 43329520 - 43329685
Alignment:
| Q |
88 |
tgagtgagtacaaacaaatattaatggnnnnnnnntgattcaccaatgagatttagttttcatgcatatatcaaaagaggaccttccaccttcatttagt |
187 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43329520 |
tgagtgagtacaaacaaatattaatggaaaaaaaatgattcaccaatgagatttagttttcatgcatatatcaaaagaggaccttccaccttcatttagt |
43329619 |
T |
|
| Q |
188 |
attatttgtcttgttaatannnnnnnaatctttttaaatggattatagattcactcctctttctct |
253 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43329620 |
attatttgtcttgttaatatttttttaatctttttaaatggattatagaatcactcctctttctct |
43329685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University