View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1700_high_30 (Length: 231)

Name: NF1700_high_30
Description: NF1700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1700_high_30
NF1700_high_30
[»] chr2 (1 HSPs)
chr2 (18-164)||(34016254-34016400)


Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 164
Target Start/End: Original strand, 34016254 - 34016400
Alignment:
18 gttttgactcttcataacattgtgtttgtggaaaatgaattgatgtagttatgtatgctgtttagtatgtagagttttatttactttttggattaattac 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34016254 gttttgactcttcataacattgtgtttgtggaaaatgaattgatgtagttatgtatgctgtttagtatgtagagttttatttactttttggattaattac 34016353  T
118 aattttaatctttattgttggctatgtgcgattttgtcttacaataa 164  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
34016354 aattttaatctttattgttggctatgtgcgattttgtcttacaataa 34016400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University