View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1700_high_33 (Length: 226)
Name: NF1700_high_33
Description: NF1700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1700_high_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 15 - 210
Target Start/End: Complemental strand, 49886099 - 49885908
Alignment:
| Q |
15 |
atcttcaccaatgaaggctgcatgcacgaaaataaatatataagtatcacaattattaacatcttgctgttaaaatagtttttgttgtagtgcaaataag |
114 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49886099 |
atcttcaccaatgaaggctgca----cgtaaataaatatataagtatcacaattattaacatcttgctgttaaaatagtttttgttgtagtgcaaataag |
49886004 |
T |
|
| Q |
115 |
taccttctttttacaaatatcatcacattcatactcctggtcaataatgattggatttttaacatttgtcatgttaatgttagtgaaaaatatctc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49886003 |
taccttctttttacaaatatcatcacattcatattcctggtcaataatgattggatttttaacatttgtcatgttaatgttagtgaaaaatatctc |
49885908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University