View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1700_low_23 (Length: 293)
Name: NF1700_low_23
Description: NF1700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1700_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 5 - 275
Target Start/End: Original strand, 9140182 - 9140451
Alignment:
| Q |
5 |
aaatggcctatttcagtgtcaaagtgacgcatcaacctatgtaacgacgactaatcaaagttnnnnnnntgttctataatgtgccggcaacttaagctga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
9140182 |
aaatggcctatttcagtgtcaaagtgacgcatcaacctatgtaacgacgactaatcaaagttaaaaaaatgttttataatgtgccggcaacttaagctga |
9140281 |
T |
|
| Q |
105 |
tttcattacaatttctttacacttgcactctactatgctagcacgccacttctctatcatcaatgtcaaccatattctttctttaattgccccctaagtt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9140282 |
tttcattacaatttctttacacttgcactctactatgctagcacgccacttctctatcatcaatgtcaaccatattctttctttaattgccccctaa-tt |
9140380 |
T |
|
| Q |
205 |
ttaatttgtctcttttaatttcctgattagatgatatctaatcatgaatcatacctttcagctacctccta |
275 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9140381 |
ttaatttgtctcttttaatttcccgattagatgatatctaatcatgaatcatacctttcagctacctccta |
9140451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University