View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1700_low_25 (Length: 264)
Name: NF1700_low_25
Description: NF1700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1700_low_25 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 13 - 264
Target Start/End: Original strand, 36876564 - 36876815
Alignment:
| Q |
13 |
atacttacgaaaataatacttacgattgagataaaccgattaacttgtttgcagcagccaacagtgatgaaaaatgttatactattggtctgaacctcaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36876564 |
atacttacgaaaataatacttacgattgagataaaccgattaacttgtttgcagcagccaacagtgatgaaaaatgttatactattggtctgaacctcaa |
36876663 |
T |
 |
| Q |
113 |
tgaaaatgaccatttggattgttggaagagttgagtttcnnnnnnnntatttactatttattagggggatagctcagtatgctgatgtaggctcatcaca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36876664 |
tgaaaatgaccatttggattgttggaagagttgagttgcaaaaaaaatatttactatttattagggggatagctcagtatgctgatgtaggctcatcaca |
36876763 |
T |
 |
| Q |
213 |
ctacaatttttgaggtccctgtaaatggcttcagaattcaaattcttgataa |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36876764 |
ctacaatttttgaggtccctgtaaatggcttcagaattcaaattcttgataa |
36876815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University