View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1700_low_31 (Length: 231)
Name: NF1700_low_31
Description: NF1700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1700_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 92 - 214
Target Start/End: Original strand, 43330092 - 43330214
Alignment:
| Q |
92 |
ctctgtataaaacatttataactttgataaacatttataactttacgtcaaaaaagaattataactttgatagagatttactttttgagtatctatggat |
191 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43330092 |
ctctttataaaacatttataactttgataaacatttataactttacgtcaaaaaagaattataactttgatagagatttactttttgagtatctatggat |
43330191 |
T |
 |
| Q |
192 |
aaaattatgaataagatttctgc |
214 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43330192 |
aaaattatgaataagatttctgc |
43330214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 43330001 - 43330060
Alignment:
| Q |
1 |
tagctctaattatatatgcatatagagtttggcttattaaagcaataaaaatgaatcttc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43330001 |
tagctctaattatatatgcatatagagtttggcttatgaaagcaataaaaatgaatcttc |
43330060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University