View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1700_low_34 (Length: 228)
Name: NF1700_low_34
Description: NF1700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1700_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 17 - 202
Target Start/End: Original strand, 24041959 - 24042156
Alignment:
| Q |
17 |
agatataaacaaaactccgacaacagcggaaaatgctgtaacagattcctcgaaaccagagtctagtgcaggtgggaaagtttctg------------tt |
104 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||| |||||||||||| |||||| |||| |||||||||||||||| || |
|
|
| T |
24041959 |
agataaaaacaaaactccgacaacaccggaaaatgctgtaacaggttcctcgaaaccggagtcttgtgctggtgggaaagtttctgaacatgtttcggtt |
24042058 |
T |
 |
| Q |
105 |
cagagcacacctcctgaacaggtgaaaatagcagccgcagaaataaaaccgctcgaacatgaaaagccggtaaaagcagcagcatctagtgctgttgc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24042059 |
cagagcacacctcctgaacaggtgaaaatagcagccgcagaaataaaaccgctcgaacatgaaaagccggtaaaagcagcagcatctagtgctgttgc |
24042156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University