View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1700_low_38 (Length: 210)
Name: NF1700_low_38
Description: NF1700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1700_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 48 - 191
Target Start/End: Original strand, 47911412 - 47911555
Alignment:
| Q |
48 |
atcgttgttgactcaacgttgtattgaggggaatccacgacagaggggaacttagggagcgaccagcggtaagtgtggacacataggaaaacgagaagga |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47911412 |
atcgttgttgactcaacgttgtattgaggggaatccatgacggaggggaacttagggagcgaccggcggtaagtgtggacacataggaaaacgagaagga |
47911511 |
T |
 |
| Q |
148 |
tacaacacgctacgaaaacagaagacaagagaaacagagttaca |
191 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
47911512 |
tacaacacgctgcgaaaacagaagacaagagcaacagagttaca |
47911555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University