View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1700_low_5 (Length: 460)
Name: NF1700_low_5
Description: NF1700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1700_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 8e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 8e-62
Query Start/End: Original strand, 324 - 456
Target Start/End: Complemental strand, 4969750 - 4969618
Alignment:
| Q |
324 |
ttgaattactaagagtaattatataatcataaaaattatcatatgagtatttgacgaaggaattagagttctataaggagtaccaacatagttaagatgt |
423 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4969750 |
ttgaattactaagagtaattatataatcataaaaattatcatatgagtatttgacgaaggaattagagttctataaggtgtaccaacatagttaagatgt |
4969651 |
T |
 |
| Q |
424 |
cttctattcttttttatttcagtattatttacc |
456 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||| |
|
|
| T |
4969650 |
cttctattcttttttatttcattataatttacc |
4969618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 16 - 130
Target Start/End: Complemental strand, 4970065 - 4969949
Alignment:
| Q |
16 |
tcactattttcgctttcttttttcgtgtcttgtttctctttctctc--atcacctccaccagccacccaaaattttcagtttgannnnnnnattataact |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4970065 |
tcactattttcgctttcttttttcgtgtcttgtttctctctctctctcatcacctccaccagccacccaaaattttcagtttgatttttttattataact |
4969966 |
T |
 |
| Q |
114 |
aaagaaaagacagaaac |
130 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
4969965 |
aaagaaaagatagaaac |
4969949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University