View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1701-Insertion-11 (Length: 509)
Name: NF1701-Insertion-11
Description: NF1701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1701-Insertion-11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 1e-85; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 7 - 199
Target Start/End: Original strand, 11740133 - 11740325
Alignment:
| Q |
7 |
aaatctctcaccttacaagacaacttcacagggttgagttagactcaactgaaattcttagaagacttgaaacttggatgaagcgtatgttgactattga |
106 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11740133 |
aaatctccccccttacaagacaacttcacagggttgagttagactcaaccgaaattcttagaagacttgaaacttggatgaagcgtatgttgattattga |
11740232 |
T |
|
| Q |
107 |
tccgtaaaacacttctaaatgatgtgtaattgcagtagctagatacatacctttgttatgggcggcgctttttactagaatataaaagttgtc |
199 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
11740233 |
tccataaaacacttctaaatgatgtgtaattgtagtagctagatacatacctttgttatgggcggcgctctttactagaatatagaagttgtc |
11740325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 391 - 457
Target Start/End: Complemental strand, 15939262 - 15939196
Alignment:
| Q |
391 |
acgagttaaccatgaaacaagtgaccaattatgacctgttttgtgattcactcctagcttcatccca |
457 |
Q |
| |
|
|||||| |||||||| ||||| |||||||||||||| |||||||||||||| |||| ||||||||| |
|
|
| T |
15939262 |
acgagtaaaccatgacacaagggaccaattatgaccggttttgtgattcacgcctaatttcatccca |
15939196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 464 - 501
Target Start/End: Complemental strand, 15952931 - 15952894
Alignment:
| Q |
464 |
tgaatatcttgcaacacaaagttccctgtatccaacaa |
501 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
15952931 |
tgaatatctttcaacacaaagttacctgtatccaacaa |
15952894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 464 - 501
Target Start/End: Original strand, 15965586 - 15965623
Alignment:
| Q |
464 |
tgaatatcttgcaacacaaagttccctgtatccaacaa |
501 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
15965586 |
tgaatatctttcaacacaaagttacctgtatccaacaa |
15965623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 464 - 501
Target Start/End: Original strand, 15984314 - 15984351
Alignment:
| Q |
464 |
tgaatatcttgcaacacaaagttccctgtatccaacaa |
501 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
15984314 |
tgaatatctttcaacacaaagttacctgtatccaacaa |
15984351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 464 - 501
Target Start/End: Original strand, 19151114 - 19151151
Alignment:
| Q |
464 |
tgaatatcttgcaacacaaagttccctgtatccaacaa |
501 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
19151114 |
tgaatatctttcaacacaaagttacctgtatccaacaa |
19151151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University