View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17010_high_11 (Length: 255)
Name: NF17010_high_11
Description: NF17010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17010_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 233
Target Start/End: Original strand, 41704886 - 41705102
Alignment:
| Q |
17 |
caaaggtgcaacaagggtgaagaccacttgcacactcaagtgctcgatttgtgtcaacatgacctgaattttccaagtaacggtgacaaatactagagga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41704886 |
caaaggtgcaacaagggtgaagaccacttgcacactcaagtgctcgatttgtgtcaacttgacctgaattttccaagtaacggtgacaaatactagagga |
41704985 |
T |
 |
| Q |
117 |
agagcagttaagaggagaaaccaagagacgaggggaacagttgaaaatgaacactgtgttggatgaagttatgttgaaaggaagtgactgatttaaccaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41704986 |
agagcagttaagaggagaaaccaagagacgaggggaacagttgaaaatgaacactgtgttggatgaagttatgttgaaaggaagtgactgatttaaccaa |
41705085 |
T |
 |
| Q |
217 |
ataccattgcttaccgg |
233 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41705086 |
ataccattgcttaccgg |
41705102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University