View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17013_high_17 (Length: 251)
Name: NF17013_high_17
Description: NF17013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17013_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 46236751 - 46236991
Alignment:
| Q |
1 |
ataaggcttggtggttgttgtatttatttaatttctccaatattcaaactataccaaatgaataaatgtcaaaatattgacttgaatctatatacnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46236751 |
ataaggcttggtggttgttgtatttatttaatttctcccatattcaaactataccaaatgaataaatgtcaaaatattgacttgaatctatatacttttt |
46236850 |
T |
|
| Q |
101 |
nnnatagaataaatattcattgattaaattgtaatttacttgataatgatacttatagtttaactagaaacaaacatgacaagtatgtaccttttctctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46236851 |
tttatagaataaatattcattgattaaattgtaatttacttgataatgatacttatagtttaactagaaacaaacatgacaagtatgtaccttttctctt |
46236950 |
T |
|
| Q |
201 |
ggcatacaacctaaagcgccgccttccttttcctgcctttg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46236951 |
ggcatacaacctaaagcgccgccttccttttcctgcctttg |
46236991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University