View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17013_high_8 (Length: 369)
Name: NF17013_high_8
Description: NF17013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17013_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 1 - 360
Target Start/End: Complemental strand, 5322018 - 5321659
Alignment:
| Q |
1 |
aggttcgaaatcagaagacaagttatggagaacaattggctaagtatgaggagaaaatgaaggaggaagtgcaaagttggaggttagctttacatgaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5322018 |
aggttcgaaatcagaagacaagttatggagaacaattggctaagtatgaggagaaaatgaaggaggaagtgcaaagttggaggttagctttacatgaaac |
5321919 |
T |
 |
| Q |
101 |
tgccagccttgcagggtggcattttagagatgggtatgtgctcttttctttcttaatttttaaaatttatttgttcaaattcttcgttggttgtttccat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5321918 |
tgccagccttgcagggtggcattttagagatgggtatgttctcttttctttcttaatttttaaaatttatttgttcaaattcttcgttggttgtttccat |
5321819 |
T |
 |
| Q |
201 |
actgttaagatgaatcacggttgtttgtaaagtgaagatgaagagtttatagcaatttagtccttcaactgtgatagtctctgaatgtatctatttttat |
300 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
5321818 |
actgttaaaatgaatcacggttgtttgtaaagtgaagataaagagtttatagcaatttagtccttgaactgtgatagtctctgaatgtatctattattat |
5321719 |
T |
 |
| Q |
301 |
aatttggattgagcctaactcagtcctaagactcctaacttaaccagaggtgagaattat |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5321718 |
aatttggattgagcctaactcagtcctaagactcctaacttaaccagaggtgaggattat |
5321659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 26 - 119
Target Start/End: Original strand, 8483998 - 8484090
Alignment:
| Q |
26 |
tggagaacaattggctaagtatgaggagaaaatgaaggaggaagtgcaaagttggaggttagctttacatgaaactgccagccttgcagggtgg |
119 |
Q |
| |
|
|||| |||||||||||||| || ||||||||||||||||||| ||||||||||||||||| |||||||| ||| ||||||| || | ||||||| |
|
|
| T |
8483998 |
tggacaacaattggctaagcataaggagaaaatgaaggaggaggtgcaaagttggaggttggctttaca-gaagctgccagtctggtagggtgg |
8484090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 26 - 81
Target Start/End: Original strand, 8077426 - 8077481
Alignment:
| Q |
26 |
tggagaacaattggctaagtatgaggagaaaatgaaggaggaagtgcaaagttgga |
81 |
Q |
| |
|
|||| |||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8077426 |
tggacaacaattggctaagcatgagtagaaaatgaaggaggaagtgcaaagttgga |
8077481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 77 - 119
Target Start/End: Original strand, 60058 - 60100
Alignment:
| Q |
77 |
ttggaggttagctttacatgaaactgccagccttgcagggtgg |
119 |
Q |
| |
|
||||||||| |||||||||||| ||||||| |||||||||||| |
|
|
| T |
60058 |
ttggaggttggctttacatgaagctgccagtcttgcagggtgg |
60100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University