View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17014_high_3 (Length: 213)
Name: NF17014_high_3
Description: NF17014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17014_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 196
Target Start/End: Original strand, 32000494 - 32000675
Alignment:
| Q |
13 |
ttaaattggttagaataagacaatattttaagaaaacaaagagattttggattctagaagatgacaccagcttataagattcatggaagagaaatttcat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
32000494 |
ttaaattggttagaataagacaatattttaagaaaacaatgagattttggattctagaagatgacaccagcttataagattcatggaagagaatctaaat |
32000593 |
T |
 |
| Q |
113 |
tcatccatagattttgaagatgctataaaaatatgaatcttttagaaaattgttaaaatc----atgaagtacatattttatttactt |
196 |
Q |
| |
|
| ||||||||||||||||||||| |||||||||||| || |||||||||||| || || ||||||||||||||| ||||| |
|
|
| T |
32000594 |
t----catagattttgaagatgctat--aaatatgaatctcttttaaaattgttaaagtcgtaaataaagtacatattttatctactt |
32000675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University