View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17015_high_17 (Length: 318)
Name: NF17015_high_17
Description: NF17015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17015_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 17 - 303
Target Start/End: Complemental strand, 35342594 - 35342308
Alignment:
| Q |
17 |
tatttcgtaaatttgatagactaattcatacgcttacaatatcgacgatgtaaattctcttgtactcaatggtacttgcctttacgtttattttttattt |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35342594 |
tatttcgtaaatttgagagactaattcatacgcttacaatatcgacgatgtaaattctcttgtactcaatggtacttgcctttacgtttattttttattt |
35342495 |
T |
 |
| Q |
117 |
tcttataatcccttacgtcctcctctcaatggtatttgggagttccctagttagggtttatctaatgatggagctttctctgctaaatctgcctattgag |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35342494 |
tcttataatcctttacgtcctcctctcaatggtatttgggagttccctagttagggtttatctaatgatggagctttctctgctaaatctgcctattgag |
35342395 |
T |
 |
| Q |
217 |
ttcctttccaaaaatcgtactaccactatgcacattaaccctctctttgatctgttgtggacttggcatgaccctcatagaattaga |
303 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35342394 |
ttcctttccaaaaatcatactaccactatgcacattaaccctctctttgatctgttgtggacttggcatgaccctcatagaattaga |
35342308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University