View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17015_high_19 (Length: 290)
Name: NF17015_high_19
Description: NF17015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17015_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 43323013 - 43322738
Alignment:
| Q |
1 |
aaaaataaagttaaaaccatatcttattgaagaatcgaatcagagagttctttataagagaagtgacacatattcacaaatcacaatgtcttaagatttt |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43323013 |
aaaaagaaagttaaaaccatatcttattgaagaatcgaatcagagagctctttataagagaagtgacacatattcataaatcacaatgtcttaagatttt |
43322914 |
T |
|
| Q |
101 |
ggatatagctagttataatttgtggtcgttggtgaaccctgatcatcattaaccc-tttgttgctcccgatgttttcctaatttctttaaggagacacta |
199 |
Q |
| |
|
||||||| ||| ||||||||||||||| ||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43322913 |
ggatatatctaattataatttgtggtcattggtgagccccgatcatcattaacccttttgttgctcccgatgttttcctaatttctttaaggagacacta |
43322814 |
T |
|
| Q |
200 |
actcatatacctaatatattaaagttttatgtgaaaatgtgatcattannnnnnnnngtattttaggatcattagt |
275 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
43322813 |
actcatatacctaatacattaaagttttatgtgaaaatgtgatcgttatttttttttgtattttaggatcattagt |
43322738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University