View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17015_low_18 (Length: 309)
Name: NF17015_low_18
Description: NF17015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17015_low_18 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 43 - 309
Target Start/End: Original strand, 26217609 - 26217875
Alignment:
| Q |
43 |
ttcgattatgttgtgtgtttgaattatggattactccgtcattgttaatagaagtgtagtggaccctatcatacttgcaagaggtcttcaacaaggggac |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26217609 |
ttcgattatgttgtgtgtttgaattatggattactccgtcattgttaatagaagtgtagtggaccctgtcatacttgcaagaggtcttcaacaaggggac |
26217708 |
T |
|
| Q |
143 |
cctttcttatgggtttctttatgatgaaggcttatcagccctgattagaaaggagaaattcacggagtctaaatatgtactaatgatctaattatctctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26217709 |
cctttcttatgggtttctttatgatgaaggtttatcagccctgattagaaaggagaaattcacggagtctaaatatgtactaatgatctaattatctctc |
26217808 |
T |
|
| Q |
243 |
atcttctatttgtagattactacttttaannnnnnnaaagcaacatagggtgaagcttgagtgatgc |
309 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26217809 |
atcttctatttgtagattactacttttaatttttttaaagcaacatagggtgaagcttgagtgatgc |
26217875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University