View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17015_low_25 (Length: 244)
Name: NF17015_low_25
Description: NF17015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17015_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 75 - 228
Target Start/End: Complemental strand, 35925806 - 35925653
Alignment:
| Q |
75 |
cttatagatgacagaaaaatgcattcaatttttaagaaatcaacttaaaattaaagaaaagaaaacaatcatgtcttttaaaatatcatttcccgaacct |
174 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||| || ||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35925806 |
cttatagatgacagaaaaatgcattcaatatctaagaaatcaacttataagaaaagaaaagcaaacaatcatgtcttttggaatatcatttcccgaacct |
35925707 |
T |
 |
| Q |
175 |
aaaccgaaaaaatatcaacaacttttcggttttactgaatattagatggagact |
228 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
35925706 |
aaaccgaaaaaatatcaagaacttttcggttttactgaaaattagatggagact |
35925653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 35925936 - 35925869
Alignment:
| Q |
1 |
caatatcttaatgttacaagtttcacaatccactttcatcaacatcagaactatttagaactgaaatatcat |
72 |
Q |
| |
|
|||||||| ||||||| ||||||| |||||||| || || ||||||||||||||||||||||||||||| |
|
|
| T |
35925936 |
caatatctcaatgttataagtttctcaatccacattaat----atcagaactatttagaactgaaatatcat |
35925869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University