View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1701_high_20 (Length: 312)
Name: NF1701_high_20
Description: NF1701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1701_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 302
Target Start/End: Original strand, 28649674 - 28649975
Alignment:
| Q |
1 |
cttcttctcttctgcgattttctttgattatacctccagggtttcgctccttcatggactcatagaaggttaaattttttcgatcttctcctcaatttct |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28649674 |
cttcttctcttctgcgaatttctttgattatacctccagggtttcgctccttcatggactcatagaaggttaaattttttcgatcttctcctcaatttct |
28649773 |
T |
 |
| Q |
101 |
ctataatctcgtatacccttttactctctgccttcaattttcattattcttcagaaatttcgcctctcaattcaattttccattgtctttcccctctttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28649774 |
ctataatctcgtatacccttttactctctgccttcaattttcattattcttcagaaatttcgcctctcaattcaattttccattctctttcccctctttc |
28649873 |
T |
 |
| Q |
201 |
aattcactacttgttgttacgaatttaacctttttgtcttgattgtgatggttttgattacccaattaccttaatttcatgacccatttctcaattcctt |
300 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28649874 |
aattcactatttgttgttacgaatttaacctttttgtcttgattgtgatggttttgattacccaattaccttaatttcatgacccatttctcaattcctt |
28649973 |
T |
 |
| Q |
301 |
tg |
302 |
Q |
| |
|
|| |
|
|
| T |
28649974 |
tg |
28649975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University