View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1701_high_28 (Length: 257)
Name: NF1701_high_28
Description: NF1701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1701_high_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 77 - 247
Target Start/End: Complemental strand, 39823742 - 39823572
Alignment:
| Q |
77 |
catgtcttcaattggtgcacgttcagctgaaatttttgttatgcagaagaggctgaaggaaaagatgaaaataatggaagaggaaagagtaagaaaggga |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39823742 |
catgtcttcaattggtgcacgttcagctgaaatttttgttatgcagaagaggctgaaggaaaagatgaaaataatggaagaggaaagagtaagaaaggga |
39823643 |
T |
|
| Q |
177 |
gaggtaagtggtgataatcaaaatagaaaggtgcaggcaagttcaaattctagtactattggtaagaataa |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39823642 |
gaggtaagtggtgataatcaaaatagaaaggtgcaggcaagttcaaattctagtactattggtaagaataa |
39823572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 77 - 247
Target Start/End: Complemental strand, 39834078 - 39833914
Alignment:
| Q |
77 |
catgtcttcaattggtgcacgttcagctgaaatttttgttatgcagaagaggctgaaggaaaagatgaaaataatggaagaggaaagagtaagaaaggga |
176 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||| ||| |
|
|
| T |
39834078 |
catgtcttccattggtgcacgttcagctgaaatttttgttatgcagaagaggatgaaggaaaagatgaaaataatggaagaagaaaaagtaagaagagga |
39833979 |
T |
|
| Q |
177 |
gaggtaagtggtgataatcaaaatagaaaggtgcaggcaagttcaaattctagtactattggtaagaataa |
247 |
Q |
| |
|
||||| ||||||||| ||||||| ||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
39833978 |
gaggtgagtggtgatgatcaaaacagaaaggtgcaag------caaattctagtactattggtaagaataa |
39833914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University