View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1701_high_3 (Length: 526)
Name: NF1701_high_3
Description: NF1701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1701_high_3 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0002 (Bit Score: 415; Significance: 0; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 415; E-Value: 0
Query Start/End: Original strand, 3 - 511
Target Start/End: Complemental strand, 447796 - 447305
Alignment:
| Q |
3 |
tattctatggattaatgataaggcaatgctgggatttgagaagacacaccacatgtacatgaaggagtaagaggctcagagaagtcaatcgagggagccg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
447796 |
tattctatggattaatgataaggcaatgctgggatttgagaagacacaccagatgtacatgaaggagaaagaggctcagagaagtcaatcgagggagccg |
447697 |
T |
|
| Q |
103 |
gttcaacaccctcattcaatggaagaggagtctggccagtaggcaccgcagtatcagtagccggtacctttgtttgttgagttattgtatgggatggcaa |
202 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
447696 |
gttcaacaccctcattcaatggaaggggagtctggccagtaggcaccgcagtatcagtagccggtacctttgtttgttgagttattgtatgggatggcaa |
447597 |
T |
|
| Q |
203 |
aatggatgcaagatgc-ttgctcagttgtgcattgatcctccttacttctctccgtaatttactaaagctgccaacaagaaatgttagggacctagaaac |
301 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
447596 |
aatggatgcaagatgctttgctcagttgtgcattgatcctccttacttctctccgtaatttactaaagctgccaacaagaaatgttagggacctagaaac |
447497 |
T |
|
| Q |
302 |
tcctatcagaggttggaacaaaggagaatatgagaggttatttatatgaggagagagaaatggcctctaggagggagcaacagattgaggaagatttagc |
401 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
447496 |
tcctatcagaggttggaactaaggagaatatgagaggttatttctatgaggagagagaaatggcctcaaggagggagcaacagattgaggaagatttagc |
447397 |
T |
|
| Q |
402 |
caatgggcaatgggcaagcagacgaagaggataatttcatgcaggggttttcctattttcatcattgttatgtttatttgagtcaaataatgtgtcctta |
501 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
447396 |
caatgggcaatgggcaagcagacgaagaggata------------------cctattttcatcattgttatgtttatttgagtcaaataatgtgtcctta |
447315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University