View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1701_high_33 (Length: 242)
Name: NF1701_high_33
Description: NF1701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1701_high_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 5 - 237
Target Start/End: Complemental strand, 55379983 - 55379758
Alignment:
| Q |
5 |
atctaacatattactagtatattttgctatcatggnnnnnnnaaagtttaaattttagagcctgttattctcatgttgcaccggcatgcttgctgatatt |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55379983 |
atctaacatattactagtatattgtgctatcatggcttttttaaaggttaaattttagagcctgttattctcatgttgcaccggcatgcttgctgatatt |
55379884 |
T |
 |
| Q |
105 |
gtatatgtggctaccggaaagttttcaaattatattacatgcataggtgcatgcatgtatacttatgatatatttcaatgaattttctcaggcatatatg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
55379883 |
gtatatgtggctaccggaaagttttcaaattatattacatgcataggtgcatgcatgtatact-------tatttcaatgaattttctcaggcatatatg |
55379791 |
T |
 |
| Q |
205 |
ttatgtccaaaagcagttggacataggtctgtg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
55379790 |
ttatgtccaaaagcagttggacataggtctgtg |
55379758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University