View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1701_high_44 (Length: 220)
Name: NF1701_high_44
Description: NF1701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1701_high_44 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 22 - 203
Target Start/End: Original strand, 4047294 - 4047475
Alignment:
| Q |
22 |
atagatttaagactttcacacatcataagacttgttgttcaaacaattgtcgttcnnnnnnntatgtatcatcttgatttgtcatgacaagagaacaaga |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4047294 |
atagatttaagactttcacacatcataagacttgttgttcaaacaattgtcgttcaaaaaaatatgtatcttcttgatttgtcatgacaagagaacaaga |
4047393 |
T |
|
| Q |
122 |
gattttcatgannnnnnnnatattaataaagagctcttgtaatcatttagtgggggtttggatgcccatttgcaccttgaat |
203 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4047394 |
gattttcatgatttttgttatattaataaagagctcttgtaatcatttagtgggggtttggatgcccatttgcaccttgaat |
4047475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University