View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1701_low_12 (Length: 382)
Name: NF1701_low_12
Description: NF1701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1701_low_12 |
 | |
|
| [»] scaffold0018 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 300; Significance: 1e-168; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 17 - 366
Target Start/End: Complemental strand, 6169872 - 6169523
Alignment:
| Q |
17 |
atcttgcagtacatgttcatgttatttaagagagaatcagttattgttttaatattcttcacctttgaatttaattctccggtgaataaattatacttgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169872 |
atcttgcagtacatgttcatgttatttatgagagaatcagttattgttttaatattcttcacctttgaatttaattctccggtgaataaattatacttgg |
6169773 |
T |
|
| Q |
117 |
tgaagaatgagagcatacatgcacaatgcagttgctgcattgccttatatcacgtcgcnnnnnnnnnnnnnngaattaaaagccaagttttatattgaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6169772 |
tgaagaatgagagcatacatgcacaatgcagttgctgcattgccttatatcacgtcgcaaaaactaaaaaaagaattaaaagccaagttttatattgaaa |
6169673 |
T |
|
| Q |
217 |
agataaaatttaaacttttaagacattgaaagccactctacaagtgcattgttggttttttaagaacgcctctctggtgccgatctgtttgagaaatagg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169672 |
agataaaatttaaacttttaagacattgaaagccactctacaagtgcattgttggttttttaagaacgcctctctggtgccgatctgtttgagaaatagg |
6169573 |
T |
|
| Q |
317 |
tggcacaactgctttctgacaagttttcagatgatttcttcgcatatatt |
366 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6169572 |
tggcacaactgctttctgacaggttttcagatgatttcttcgcatatatt |
6169523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 366
Target Start/End: Original strand, 8500727 - 8500817
Alignment:
| Q |
275 |
tttaagaacgcctctctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaagttttcagatgatttcttcgcatatatt |
366 |
Q |
| |
|
||||||||||| ||||||||||| ||| |||||||||| |||||||| || || |||| | || | ||| || ||||||||||||||||||| |
|
|
| T |
8500727 |
tttaagaacgcatctctggtgcccatccgtttgagaaacaggtggcataattgttttc-ggcaggattttaggtgatttcttcgcatatatt |
8500817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 274 - 365
Target Start/End: Original strand, 14103112 - 14103203
Alignment:
| Q |
274 |
ttttaagaacgcctctctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaagttttcagatgatttcttcgcatatat |
365 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||| |||||||||||||| |||| |||| ||||| || ||||||||||| |||||| |
|
|
| T |
14103112 |
ttttaagaaagcctctctggtgccgatccgtttgagaaacaggtggcacaactgttttccgacaggttttaaggtgatttcttcgaatatat |
14103203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 253 - 367
Target Start/End: Original strand, 153148 - 153261
Alignment:
| Q |
253 |
tctacaagtgcattgttggttttttaagaacgcctctctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaagttttcagatgatt |
352 |
Q |
| |
|
||||| ||||||| ||||| |||| || || |||||| ||||||||||| |||||||||| ||||| |||||||||||| ||| |||||||| || || |
|
|
| T |
153148 |
tctactagtgcatagttggctttt-aataatgcctctttggtgccgatccgtttgagaaacaggtgccacaactgcttttcaacaggttttcaggtggtt |
153246 |
T |
|
| Q |
353 |
tcttcgcatatattt |
367 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
153247 |
tcttcgcatatattt |
153261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 288 - 366
Target Start/End: Original strand, 32879616 - 32879694
Alignment:
| Q |
288 |
ctctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaagttttcagatgatttcttcgcatatatt |
366 |
Q |
| |
|
|||||||||||||| |||||| ||| | |||||||| |||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
32879616 |
ctctggtgccgatccgtttgaaaaaccgatggcacaattgctttctgacatgttttcaggtgatttcttcgcatatatt |
32879694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 286 - 366
Target Start/End: Complemental strand, 41444031 - 41443951
Alignment:
| Q |
286 |
ctctctggtgccgatctgtttgagaaataggtggcacaactgctttctgacaagttttcagatgatttcttcgcatatatt |
366 |
Q |
| |
|
|||||||||| |||| |||||||||| ||||||||||||||||| | |||| |||||||| ||||| |||| |||||||| |
|
|
| T |
41444031 |
ctctctggtgttgatccgtttgagaaacaggtggcacaactgcttaccgacaggttttcaggtgattccttcacatatatt |
41443951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University