View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1701_low_25 (Length: 277)
Name: NF1701_low_25
Description: NF1701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1701_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 33699383 - 33699118
Alignment:
| Q |
1 |
gtagtttaacaaatggcctaatagccccttctcattcaatctctgctcctttctcttgcaaattatctcacttataatctcttgaattcgccgcctcgcc |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33699383 |
gtagtttaacaaatggcctaatagatccttctcattcaatctttgctcctttctcttgcaaattatctcacttataatctcttgaattcgccgcctcgcc |
33699284 |
T |
|
| Q |
101 |
taatataattagacaatttaaccaatttttagtcaagttatattattctagaacttttatactgcgaccgcaattgcagttagtgatcgaaatttagaac |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33699283 |
taatttaattagacaatttaaccaatttttagtcaagttatattattctaaaacttttatactgcgaccgcaattgcagttagtgatcgaaatttagaac |
33699184 |
T |
|
| Q |
201 |
tactaaaatcatatataaaccaaaagttgcagtgcagtggagcttaccaaaagagctttggagtat |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33699183 |
tactaaaatcatatataaaccaaaagttgcagtgcagtggagcttaccaaaagagctttggagtat |
33699118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 33658697 - 33658597
Alignment:
| Q |
1 |
gtagtttaacaaatggcctaatagccccttctcattcaatctctgctcctttctcttgcaaattatctcacttataatctcttgaattcgccgcctcgcc |
100 |
Q |
| |
|
||||||||| || | ||||||||| ||||||| ||||||||||||||||| ||||||||||||| |||||||||||||| |||||| | |||||||| |
|
|
| T |
33658697 |
gtagtttaagaagttgcctaatagattcttctcaatcaatctctgctcctttttcttgcaaattatttcacttataatctcccgaattctctgcctcgcc |
33658598 |
T |
|
| Q |
101 |
t |
101 |
Q |
| |
|
| |
|
|
| T |
33658597 |
t |
33658597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University