View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1701_low_26 (Length: 268)
Name: NF1701_low_26
Description: NF1701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1701_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 266
Target Start/End: Complemental strand, 44259871 - 44259623
Alignment:
| Q |
18 |
actaatatgaccatgatataaaaatgtcaaaatcaaaattgagtggcatgcaaattgtgagattggatcttaagtcaaatcaaaattaccaattatattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44259871 |
actaatatgaccatgatataaaaatggcaaaatcaaaattgagtggcatgcaaattgtgagattggatcttaagtcaaatcaaaattaccaattatattg |
44259772 |
T |
 |
| Q |
118 |
atttgaaatagtccaataatcaaaagaaagagatagaaaaaagagcaatgcatgaataaacaattaatgaggacccctaactatgggagacatccctaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44259771 |
atttgaaatagtccaataatcaaaagaaagagatagaaaaaagagcaatgcatgaataaacaattaatgaggacccctaactatgggagacatccctaaa |
44259672 |
T |
 |
| Q |
218 |
tgcatagtttccaggaacagatacacaaaaactaaggactcatcatatt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44259671 |
tgcatagtttccaggaacagatacacaaaaactaaggactcatcatatt |
44259623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University