View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1701_low_38 (Length: 233)
Name: NF1701_low_38
Description: NF1701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1701_low_38 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 38504285 - 38504500
Alignment:
| Q |
18 |
atttgtatttgctcaggttagtttaggacgttatctagtgtttctttcttgcaaactttgtggctttgagtatatccagcaacactcagattctctgcag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38504285 |
atttgtatttgctcaggttagtttaggacgttatctagtgtttctttcttgcaaactttgtggctttgagtatatccagcaacactcagattctctgcag |
38504384 |
T |
|
| Q |
118 |
tcagggaatccacacagtcacgtagtcagcatgtaaggagttgttcgatcaaagatcagatggcttggatcgcttgatggaggatacccgacttcaggga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38504385 |
tcagggaatccacacagtcacgtagtcagcatgtaaggaattgttcgatcaaagatcagatggcttggatcgcttgatggaggatacccgacttcaggga |
38504484 |
T |
|
| Q |
218 |
atccaattcccaagtt |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38504485 |
atccaattcccaagtt |
38504500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University