View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1701_low_42 (Length: 225)
Name: NF1701_low_42
Description: NF1701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1701_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 28 - 211
Target Start/End: Complemental strand, 6412459 - 6412276
Alignment:
| Q |
28 |
agaactttgtcacaaccgcctcctcattattgatgagcgcaacatccgtcacatgaataatgatgctacttgttgtcaatgtggtgctaaaaaagaaaca |
127 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6412459 |
agaactttgtcacaactgcctcctcattattgatgagcgcaacatccgtcacatgaataatgatgctacttgttgtcaatgtggtgctaaaaaagaaaca |
6412360 |
T |
 |
| Q |
128 |
attatgcatttgcttagagattgttatgacatccaagatgtttgggatccttctattaagtaggagcattgggctaaattattt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6412359 |
attatgcatttgcttagagattgttatgacatccaagatgtttgggatccttctattaagtaggagcattgggctaaattattt |
6412276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 61 - 151
Target Start/End: Original strand, 38002360 - 38002450
Alignment:
| Q |
61 |
tgagcgcaacatccgtcacatgaataatgatgctacttgttgtcaatgtggtgctaaaaaagaaacaattatgcatttgcttagagattgt |
151 |
Q |
| |
|
|||||||| ||||||||||||| | |||||| |||||| | |||||||||| | | ||||||||||||||||| |||||||||||| |
|
|
| T |
38002360 |
tgagcgcagaatccgtcacatgactgatgatgttacttgagtttgatgtggtgcttaggaggaaacaattatgcatttacttagagattgt |
38002450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University