View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1701_low_45 (Length: 223)
Name: NF1701_low_45
Description: NF1701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1701_low_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 15 - 207
Target Start/End: Original strand, 280140 - 280333
Alignment:
| Q |
15 |
cagagatggtggcttcatgaacttccaatggacaaatgttaattggaaagttagtcagaaaaatcaaacttaggtatgatttaggggatacatagagatt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
280140 |
cagagatggtggcttcatgaacttccaatggacaaatgttaattggaaagttagtcagaaaaatcaaacttaggtatgatttaagggatacatagagatt |
280239 |
T |
|
| Q |
115 |
gtaatttcagttaatgaagtggacattcatttatgtcatgttta-tgatttcttagatatgattgttgttcttgattaatcggtggtataattt |
207 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
280240 |
gtaatttcagttaatgaagtggacatccatttatgtcatgtttagtgatttcttagatatgattgttgttcttgattaatcggtggtataattt |
280333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 88 - 207
Target Start/End: Original strand, 265796 - 265916
Alignment:
| Q |
88 |
gtatgatttaggggatacatagagattgtaatttcagttaatgaagtggacattcatttatgtcatgttta-tgatttcttagatatgattgttgttctt |
186 |
Q |
| |
|
|||| |||| |||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
265796 |
gtataatttggggggtacagagagattgtaatttcagttaatgaagtgaacattcatttatgtcatgtttagtgttttcttagacatgattgttgttctt |
265895 |
T |
|
| Q |
187 |
gattaatcggtggtataattt |
207 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
265896 |
gattaatcggtggtataattt |
265916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University