View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1701_low_49 (Length: 214)
Name: NF1701_low_49
Description: NF1701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1701_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 198
Target Start/End: Original strand, 6251186 - 6251367
Alignment:
| Q |
19 |
atatgcttctctagatagtaaataatgaagaaaagtatatagtatatatcttattttttggtacta--atttgatctttaccgaccgatataatttacat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6251186 |
atatgcttctctagatagtaaataatgaagaaaagtatatagtatatatcttattttttggtactataatttgatctttaccgaccgatataatttacat |
6251285 |
T |
 |
| Q |
117 |
agaaaattctagtttattttcttcttttcatggaaaaaataggatctagttgaaaatttgtacacgattaattggttttcat |
198 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6251286 |
agaaaaatttagtttattttcttcttttcatggaaaaaataggatctagttgaaaatttgtacacgattaattggttttcat |
6251367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 73 - 195
Target Start/End: Original strand, 6183721 - 6183841
Alignment:
| Q |
73 |
tttttggtactaatttgatctttaccgaccgatataatttacatagaaaattctagtttattttcttcttttcatgg-aaaaaataggatctagttgaaa |
171 |
Q |
| |
|
|||||||||||||||||||||| || || |||||||||||||| ||||| ||||||||||| |||||||||||| ||||||||| |||||||||||| |
|
|
| T |
6183721 |
tttttggtactaatttgatcttcactgatcgatataatttacaaagaaatatctagtttatt---ttcttttcatggaaaaaaatagaatctagttgaaa |
6183817 |
T |
 |
| Q |
172 |
atttgtacacgattaattggtttt |
195 |
Q |
| |
|
|||||| |||||||||| |||||| |
|
|
| T |
6183818 |
atttgtgcacgattaatcggtttt |
6183841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University