View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1701_low_51 (Length: 204)

Name: NF1701_low_51
Description: NF1701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1701_low_51
NF1701_low_51
[»] chr6 (4 HSPs)
chr6 (52-186)||(17725685-17725819)
chr6 (70-169)||(17698444-17698543)
chr6 (142-186)||(17734650-17734694)
chr6 (142-186)||(17737389-17737433)


Alignment Details
Target: chr6 (Bit Score: 119; Significance: 5e-61; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 52 - 186
Target Start/End: Complemental strand, 17725819 - 17725685
Alignment:
52 ttgatgttcttttcggttgagcatgcttcttggcttctgttgctcggtttggtttggtgcttctcctggtaggtggttacaaggctcctggtttattttt 151  Q
    |||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||    
17725819 ttgatgctcttttcggttgggcatgcttcttggcttctgttgctcggtttggtttggtgcttcgcctggtaggtggttacatggctcctggtttattttt 17725720  T
152 ctggttctttgcttgttgcagttctggtggttctt 186  Q
    |||||||||||||||||||||||||||||||||||    
17725719 ctggttctttgcttgttgcagttctggtggttctt 17725685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 70 - 169
Target Start/End: Complemental strand, 17698543 - 17698444
Alignment:
70 gagcatgcttcttggcttctgttgctcggtttggtttggtgcttctcctggtaggtggttacaaggctcctggtttatttttctggttctttgcttgttg 169  Q
    |||||||||||| |  |||| ||| || ||||||||||| | | | |||||||| |||||||  ||||||||||||||||||||||||||||||||||||    
17698543 gagcatgcttctggttttcttttgatcagtttggtttggggatacgcctggtagttggttacctggctcctggtttatttttctggttctttgcttgttg 17698444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 142 - 186
Target Start/End: Complemental strand, 17734694 - 17734650
Alignment:
142 gtttatttttctggttctttgcttgttgcagttctggtggttctt 186  Q
    |||||||||||||||| |||||||||||| |||||||||||||||    
17734694 gtttatttttctggttgtttgcttgttgctgttctggtggttctt 17734650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 142 - 186
Target Start/End: Complemental strand, 17737433 - 17737389
Alignment:
142 gtttatttttctggttctttgcttgttgcagttctggtggttctt 186  Q
    |||||||||||||||||||| ||| |||| |||||||||||||||    
17737433 gtttatttttctggttcttttcttcttgcggttctggtggttctt 17737389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University