View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17020_high_22 (Length: 330)
Name: NF17020_high_22
Description: NF17020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17020_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 22 - 158
Target Start/End: Original strand, 13982638 - 13982774
Alignment:
| Q |
22 |
catcatcatcatttttgccccataaatctctctctattctttttaccctaaaacacacaaacccatttcctacataaacctcttcatctttcatcactct |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13982638 |
catcatcatcatttttgccccataaatctctctctattctttttaccctaaaacacacaaacccatttcctacataaacctcttcatctttcatcactct |
13982737 |
T |
|
| Q |
122 |
cacactctctttccatgttcaaccagtgccatttcaa |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13982738 |
cacactctctttccatgttcaaccagtgccatttcaa |
13982774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 250 - 330
Target Start/End: Original strand, 13982866 - 13982946
Alignment:
| Q |
250 |
atcaacctctctttcaatggctgaaagctttgacagtgctgaatctaatcttttatgtagtgaaaacaatagcacatgttt |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13982866 |
atcaacctctctttcaatggctgaaagctttgacagtgctgaatctaatcttttatgtagtgaaaacaatagcacatgttt |
13982946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University