View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17021_high_4 (Length: 242)
Name: NF17021_high_4
Description: NF17021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17021_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 44735163 - 44735385
Alignment:
| Q |
1 |
aattatatattttatctgtctcattataaatgtattattcgtttttgatgtctcaaaactttaaaatatcaataaacaattgatttactttttattagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44735163 |
aattatatattttatctgtctcattataaatgtattattcgttttttatgtctcaaaactttaaaatatcaataaacaattgatttactttttattagcc |
44735262 |
T |
|
| Q |
101 |
tnnnnnnngtaaaattaataagcttttgtaataatgaaattctcttttatcattaaaa-taacccaactaattatttacttaaaagtcgcgcccaaatca |
199 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44735263 |
taaaaaaagtaaaattaataagcttttgtaataatgaaattctcttttatcattaaaattaacccaactaattatttacttaaaagtcgcgcccaaatca |
44735362 |
T |
|
| Q |
200 |
aaaatcttatactgagatatctt |
222 |
Q |
| |
|
||| |||||||||| |||||||| |
|
|
| T |
44735363 |
aaactcttatactgggatatctt |
44735385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University