View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17023_low_4 (Length: 305)
Name: NF17023_low_4
Description: NF17023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17023_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 19 - 175
Target Start/End: Complemental strand, 2297324 - 2297168
Alignment:
| Q |
19 |
caatcgagttccctttttgatatggtatccgcctattgtgcaatcttctgtgaattcgcgaggtgacgaaaatggagctggtggatagaatcttagtgtc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2297324 |
caatcgagttccctttttgatatggtatccacctattgtgcaatcttctgtgaattcgcgaggtgacgaaaatggagctggtggatagaatcttagtgtc |
2297225 |
T |
|
| Q |
119 |
tctttaattatagcatcaagatatactaatttattaacatctgactctcttacacaa |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2297224 |
tctttaattatagcatcaagatatactaatttattaacatctgactctcttacacaa |
2297168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 239 - 295
Target Start/End: Complemental strand, 2297104 - 2297048
Alignment:
| Q |
239 |
aatagtaaagacattgcccatgtaagtgttccagcggttgtgtcacttcctcctatg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2297104 |
aatagtaaagacattgcccatgtaagtgttccagcggttgtgtcacttcctcctatg |
2297048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University