View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17024_high_5 (Length: 208)
Name: NF17024_high_5
Description: NF17024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17024_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 38554615 - 38554447
Alignment:
| Q |
19 |
gtattgttcacatcagcgttgttcgcatcacgaacaccgttcatcatgatcattgtccacattcgcgcattgctcccctcgttagtactg--ttcacacc |
116 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
38554615 |
gtattgttcacatcagcattgtttgcatcacgaacaccgttcatcatgatcattgtccacattcgcgcattgttcacctcgttagtactgtattcacacc |
38554516 |
T |
 |
| Q |
117 |
gcgatcacaactacaataagtaaaatttagctataaactcgccaaaaaacgacaatcatctaaatgtgaacttat |
191 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
38554515 |
acgat------tacaatgagtaaaatttagctataaactcacgaaaaaacgacaatcatctaaatgtgaacttat |
38554447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University