View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17024_low_8 (Length: 204)
Name: NF17024_low_8
Description: NF17024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17024_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 193
Target Start/End: Original strand, 2608978 - 2609154
Alignment:
| Q |
17 |
ggattgtgagcatagcaacatgatttttggtaattgcgaattggtaatgctaagaaccatggtgtagactcatgaggtttgtatttggttatgaaagttc |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2608978 |
ggattgtgagcataacaacatgatttttggtaattgcgaattggtagtgctaagaaccatggtgtagactcatgaggtttgtatttggttatggaagttc |
2609077 |
T |
|
| Q |
117 |
cacatgtgtgccaattcttgcaagttgaccttgctcttgctaaggaatctggagagagaaaagaggagattgatgat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
2609078 |
cacatgtgtgccaattcttgcaagttgatcttgctcttgctaaggaatctggagagagaaaagagaagatggatgat |
2609154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University