View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17025_high_30 (Length: 210)
Name: NF17025_high_30
Description: NF17025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17025_high_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 189
Target Start/End: Original strand, 30761433 - 30761607
Alignment:
| Q |
15 |
agaatattcggagctaaaattgacaagatatttatatattatgtgctaaacttgggtgcgaaatcccggacgcacagctaaaagtgctaagattgtttgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30761433 |
agaatattcggagctaaaattgacaagatatttatatattatgtgctaaacttgggtgcgaaatcccggacgcacagctaaaagtgctaagattgtttgt |
30761532 |
T |
|
| Q |
115 |
taatgatgaaaactcttggcctaatctaagatcttagtatgttagcagttagacctttcgggattttagtttaag |
189 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30761533 |
taatgatgaaaactcttggactaatctaagatcttagtatgttagcagttagacctttcggggttttagtttaag |
30761607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University