View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17025_low_22 (Length: 263)
Name: NF17025_low_22
Description: NF17025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17025_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 13 - 249
Target Start/End: Original strand, 43105480 - 43105716
Alignment:
| Q |
13 |
tcaaaaatcactacagctccagccattataaatgaacaaaaagctaattttgatgagataactatataactctgtgaagatgatcaaggacaaacaaagg |
112 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43105480 |
tcaaaaatcactacaactccagccattataaatgaacaaaaagctaattttgatgagataactatataactctgtgaagatgatcaaggacaaacaaagg |
43105579 |
T |
|
| Q |
113 |
gtatttataggcaaatagagtgcaaggtttgcacataagcaagatatttaggatttatttatatatttaaattaatataggacctttggattccatggaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43105580 |
gtatttataggcaaatagagtgcaaggtttgcacataagcaagatatttaggatttatttatatatttaaattaatataggacctttggattccatggaa |
43105679 |
T |
|
| Q |
213 |
tataccagtgttgattggatgggtattatatttttat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43105680 |
tataccagtgttgattggatgggtattatatttttat |
43105716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University