View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17025_low_26 (Length: 249)
Name: NF17025_low_26
Description: NF17025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17025_low_26 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 13 - 249
Target Start/End: Original strand, 9194413 - 9194649
Alignment:
| Q |
13 |
aaaattggaatctcgtacaccaagctaaatctatgttccaaacatcctcgtcagaatcaaactcaaatttagatcttacctccaccaccccacttgacaa |
112 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9194413 |
aaaattggaacctcgtgcaccaagctaaatctatgttccaaacatcctcgtcagaatcaaactcaaatttagatcttacctccaccaccccatttgacaa |
9194512 |
T |
 |
| Q |
113 |
atgtaaaacattcatccaaaacacatcttttgcaaacatgggtgtcgtctctggcggtagcgcgagagaagacacccatgagaagccaaaaaatttgcaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9194513 |
atgtaaaacattcatccaaaacacatcttttgccaacatgggtgtcgtctctggcggtagcgcgagagaagacccccatgagaagccaaaaaatttgcaa |
9194612 |
T |
 |
| Q |
213 |
gaaaaacataaaaatgtttcatcatgttctttagatt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9194613 |
gaaaaacataaaaatgtttcatcatgttctttagatt |
9194649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 13 - 114
Target Start/End: Complemental strand, 9213614 - 9213513
Alignment:
| Q |
13 |
aaaattggaatctcgtacaccaagctaaatctatgttccaaacatcctcgtcagaatcaaactcaaatttagatcttacctccaccaccccacttgacaa |
112 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||| |||||| | ||||||||||| |
|
|
| T |
9213614 |
aaaattggaacctagtacaccaagctaaatctatgttccaaacatcctcgtcagaatctaactcagaaatagatcttatctccacaaatccacttgacaa |
9213515 |
T |
 |
| Q |
113 |
at |
114 |
Q |
| |
|
|| |
|
|
| T |
9213514 |
at |
9213513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University