View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17025_low_28 (Length: 241)
Name: NF17025_low_28
Description: NF17025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17025_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 13 - 227
Target Start/End: Original strand, 5663296 - 5663511
Alignment:
| Q |
13 |
attatactactgttgttataatagttttcttctatgctgatattgctaacatgttactataaactgcttatgagaatcatgtgnnnnnnnn-cttttgtg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| ||| |||| |
|
|
| T |
5663296 |
attatactactgttgttataatagttttcttctgtgctgatattgctaacatgttactataatctgcttatgagaatcatgtgtttttttttcttctgtg |
5663395 |
T |
|
| Q |
112 |
ttgactttgctattctgttataacaatgatattcttcaagttgttgttataattttttggaatgctattctgttttcattgtcatgtttgcttctttaat |
211 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5663396 |
ttgactttgctattctgttataataatgatattcttcaagttgatgttataattttttggaatgctattctgtttccattgtcatgtttgcttctttaac |
5663495 |
T |
|
| Q |
212 |
tgtgttaagttgattt |
227 |
Q |
| |
|
| ||| |||||||||| |
|
|
| T |
5663496 |
tatgtcaagttgattt |
5663511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University