View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17025_low_35 (Length: 219)
Name: NF17025_low_35
Description: NF17025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17025_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 21837138 - 21837337
Alignment:
| Q |
1 |
tatcgaaatagtgtctactattacatcctagacactactattttgtttaatacgtatatatgatgctcaccttcatgagagaactttgtaaagcatcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21837138 |
tatcgaaatagtgtctactattacattctagacactactattt-gtttaatacgtatatatgatgctcaccttcatgagagaactttgtaaaggatcttt |
21837236 |
T |
|
| Q |
101 |
gagccgcctcaaatatatgtgatacctgcaagccacttttaaggttgacgattgtatatcaacatttgtgaaaggatattgaaacttgaaaccagatggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21837237 |
gagccgcctcaaatatatgtgatacctgcaagccacttttaaggttgacgattgtatatcaacatttgtgaaaggatattgaaacttgaaaccagatggg |
21837336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University