View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17026_low_4 (Length: 220)
Name: NF17026_low_4
Description: NF17026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17026_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 5138917 - 5138708
Alignment:
| Q |
1 |
tgaaatgtgaatgtaaccattgaatttatgtctcaaattttgcaaaggataatgctaaatcttgtgacaaaaaatataacaaaagtctctcggttgctct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
5138917 |
tgaaatgtgaatgtaaccattgaatttatgtctcaaattttgcaaaggataatgctagatcttgtgacaaaaaatgttacaaaagtctctcggttgctct |
5138818 |
T |
|
| Q |
101 |
ctccagcagcattatacatcctgaaagaaaacaaacattctccaatgcaaaacacaaaccagcctcatcctcattcgacattcgtctgcaacttccatgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5138817 |
ctccagcagcattatacatcctgaaagaaaa-atatattctccaatgcaaaacacaaaccagcctcatcctcattcgacattcgtctgcaacttccatgg |
5138719 |
T |
|
| Q |
201 |
catattcttcg |
211 |
Q |
| |
|
||| ||||||| |
|
|
| T |
5138718 |
cattttcttcg |
5138708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University