View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17027_low_17 (Length: 279)
Name: NF17027_low_17
Description: NF17027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17027_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 7 - 263
Target Start/End: Original strand, 1158507 - 1158760
Alignment:
| Q |
7 |
atgtccaagaaaatattgtgtataattcaaaatctgggagctttttcttgacgtatattaacaacattttcaaacagaatattttatattctttgacctc |
106 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1158507 |
atgtcaaaaaaaatattgtgtataattcaaaatctgggagctttatcttgacgtatattaacaacattttcaaacagaatattttatattctttgacctc |
1158606 |
T |
|
| Q |
107 |
attttcattaacttgtggacaatgccgccattaacatttcattaacttgttttgcaaattattgtagtaggagtacatcaaaactgtgaactcatgtaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1158607 |
attttcattaacttgtggacaatgcc---attaacatttcattaacttgttttgcaaattattgtagtaggagtacatcaaaactgtgaactcatgtaag |
1158703 |
T |
|
| Q |
207 |
ttaccacccttcttctgattttctttgaataacaaatccttgttttgtaccacatat |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1158704 |
ttaccacccttcttctgattttctttgaataacaaatccttgttttgtaccacatat |
1158760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University